View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6207_low_6 (Length: 206)

Name: NF6207_low_6
Description: NF6207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6207_low_6
NF6207_low_6
[»] chr6 (2 HSPs)
chr6 (1-168)||(3642360-3642527)
chr6 (163-206)||(3642220-3642263)


Alignment Details
Target: chr6 (Bit Score: 164; Significance: 7e-88; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 3642527 - 3642360
Alignment:
1 aaatcttccttatatttttcaagagttgttttgaaaaaattaaaagacaatatgagctatatgagttcctttaaacaagattttactttcaaattttata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3642527 aaatcttccttatatttttcaagagttgttttgaaaaaattaaaagacaatatgagctatatgagttcctttaaacaagattttactttcaaattttata 3642428  T
101 aataagatgattatcatccacaaaagatgattagccatatactttaacgggcattagtaattgttaaa 168  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
3642427 aataagatgattatcatccacaaaagatgattagccatatactttaacgggcattagtaattgataaa 3642360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 163 - 206
Target Start/End: Complemental strand, 3642263 - 3642220
Alignment:
163 gttaaaattggagataacaatggacgaaagtagagatttcatac 206  Q
    |||||||||||||||||||||||| |||||||||||||||||||    
3642263 gttaaaattggagataacaatggaagaaagtagagatttcatac 3642220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University