View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6208_high_4 (Length: 382)
Name: NF6208_high_4
Description: NF6208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6208_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 9 - 206
Target Start/End: Complemental strand, 38220418 - 38220221
Alignment:
| Q |
9 |
agcagagagagttatttatcagcacaacgatatggattactacgtcatgccattggtggtctcgtgactcatgtcagaaacctcaaattaattagggtat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38220418 |
agcagagagagttatttatcagcacaacgatatggattactacgtcattccattggtggtctcgtgactcatgtcagaaacctcaaattaattagggtat |
38220319 |
T |
 |
| Q |
109 |
gtgattctaatcacatggcaccatcacattggattcttaaagcatgatccattgatccttaaacctatggagaagtaatatcgtttttggttttgaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38220318 |
gtgattctaatcacatggcaccatcacattggattcttaaagcatgatccattgatccttaaacctatggagaagtaatatcgtttttggttttgaaa |
38220221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 315 - 365
Target Start/End: Complemental strand, 38219666 - 38219616
Alignment:
| Q |
315 |
agtagatcggttccttcatcaacattcaaatccagttggcatcgacgacct |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38219666 |
agtagatcggttccttcatcaacattcaaatccagttggcatcgacgacct |
38219616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 277 - 319
Target Start/End: Complemental strand, 38220150 - 38220108
Alignment:
| Q |
277 |
ggtatgttgaaggtggttctagggtgcaccattttataagtag |
319 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38220150 |
ggtaagttgaaggtggttctagggtgcaccattttataagtag |
38220108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University