View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6208_high_8 (Length: 366)
Name: NF6208_high_8
Description: NF6208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6208_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 1 - 351
Target Start/End: Original strand, 24781985 - 24782335
Alignment:
| Q |
1 |
aagtgaagaaatgcacttggggatctcaccggagataccgttccaatcagtgattgtaatgcttgaaagttgagttagcttacaaatctccggggagatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24781985 |
aagtgaagaaatgcacttggggatctcaccggagataccgttccaatcagtgattgtaatgcttgaaagtttagttagcttacaaatctccggggagatt |
24782084 |
T |
 |
| Q |
101 |
tgaccggtcatgtagccaggtttacgtgctttttcgaaggtggtgtagagagttccggcacggaggtttatatcggctacacgacgagtattctcgtcgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24782085 |
tgaccggtcatgtagccaggtttacgtgctttttcgaaggtggtgtagagagttccggcacggaggtttatatcggctacgcgacgagtattctcgtcgc |
24782184 |
T |
 |
| Q |
201 |
atgatacgcccaaccagttgtggcagcagtcagttccggtccatgagttgaatactccgtcgttaggttcacggagtgaggcttttatggcttgtagggc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24782185 |
atgatacgcccaaccagttgtggcagcagtcagttccggtccatgagttgaatattccgtcgttaggttcacggagtgaggcttttatggcttgtagggc |
24782284 |
T |
 |
| Q |
301 |
tttgagttctgatggaagacatgagttaacggtggaggtaacggtggagat |
351 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24782285 |
tttgagttctgatggaagacatgagttagcggtggaggtaacggtggagat |
24782335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University