View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6208_low_13 (Length: 261)
Name: NF6208_low_13
Description: NF6208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6208_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 20 - 249
Target Start/End: Original strand, 16634784 - 16635013
Alignment:
| Q |
20 |
ttaaactatcttttaactggttcgatcaaataaaatatatgtgtggctaaataaagataaagttttagtgcttcataaatattagtaatttgtttaatgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16634784 |
ttaaactatcttttaactggttcgatcaaataaaatatatgtgtggctaaataaaggtaaagttttagtgcttcataaatattagtaatttatttaatgt |
16634883 |
T |
 |
| Q |
120 |
ttttaattatctagatcaaacggactactcattgtccatacgggttaaccctaatggatagcgggctatttaaggcgatattaaaaagccttgaaaaagc |
219 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||| ||||||||||||||| | || |||||| ||||| ||||||||||| ||||| | |
|
|
| T |
16634884 |
ttttaattatctagatcaaatgggctactcattgtccatacggactaaccctaatggataacaggttatttagggcgagattaaaaagccctgaaataat |
16634983 |
T |
 |
| Q |
220 |
tcgggctagaagtgtaagacctaaatccta |
249 |
Q |
| |
|
||||||||||||||||||| |||||||||| |
|
|
| T |
16634984 |
tcgggctagaagtgtaagatctaaatccta |
16635013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University