View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6208_low_3 (Length: 390)
Name: NF6208_low_3
Description: NF6208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6208_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 39 - 379
Target Start/End: Complemental strand, 25990082 - 25989745
Alignment:
| Q |
39 |
tagtttggcatgctatcttttgtaaactatctttaagaatgttgtatctttctgggtttagttggtaat--ggactttgaaacaacagtgaataaagaat |
136 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||| | ||||||||| ||||||||||||||||||||| |||| || |||||| |||||||| |
|
|
| T |
25990082 |
tagtttagcatgctatcttttgtaaactagctttatggatgttgtatttttctgggtttagttggtaattaggaccttcaaacaatggtgaataag---- |
25989987 |
T |
 |
| Q |
137 |
tgaaattggagaatgttatgctcttcttgataggataatctagcatacttgttttgtttgattgtt-ctttgccttaacgttttctttgatatgctttta |
235 |
Q |
| |
|
|||||||| ||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
25989986 |
---aattggaggatgctatgctctttttgataggataatctagcatacttgttttgtttgattgtttctttgcctcaacgttttctttgatatgctttta |
25989890 |
T |
 |
| Q |
236 |
tcgttcccttgtgctgtgttcgaaaggtcactcacaaaattttaagttcaagttgatcggttgcaatactttaatc-atacttacatttgaatatcctta |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25989889 |
tcgttcccttgtgctgtgttcgaaaggtcactcaccaaattttatgttcaagttgatcggttgcaatactttaatcaatacttacatttgaatatcctta |
25989790 |
T |
 |
| Q |
335 |
attttcctaaactcattcaataattcattttctctctagctctct |
379 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25989789 |
attttcctaaactcattcaacaattcattttctctctagctctct |
25989745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University