View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6208_low_7 (Length: 373)
Name: NF6208_low_7
Description: NF6208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6208_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 20 - 365
Target Start/End: Complemental strand, 32824619 - 32824274
Alignment:
| Q |
20 |
cattgtttattaacatgatgtttgtggataataattgatagatgtttgtgtttggtgtgtgtaagcaattaagatttatatatattgttttaaatatttt |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32824619 |
cattgtttattgacatgatgtttgtggataataattgatagatgtttgtgtttggtgtgtgtaagcaattaagatttatatatattgttttaaatatttt |
32824520 |
T |
|
| Q |
120 |
attgatcagtgtatgaattaggatagttatatagaaagttcagaattgtttctggaaattgccaatgattatgaaaatagtagataacttgaagataatg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32824519 |
attgatcagtgtatgaattaggatagttatatagaaagttcagaattgtttctggaaattgccaatgattatgaaaatagtagataacttgaagataatg |
32824420 |
T |
|
| Q |
220 |
tctcattgtcatatgagataaaatagtaaatattgataactttgttcgctcaatatttaggataggaaggaacttgaagaaaaaattcctataatctttt |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32824419 |
tctcattgtcatatgagataaaatagtaaatattgataactttgtctgctcaatatttaggataggaaggaacttgaagaaaaaattcctataatctttt |
32824320 |
T |
|
| Q |
320 |
ctcaatctcttagttttaattttattttatgaacattcttcatctc |
365 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
32824319 |
ctcaatctcttaattttaattttattttatgaacattcttcttctc |
32824274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University