View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_high_22 (Length: 392)
Name: NF6210_high_22
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 9e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 240 - 371
Target Start/End: Original strand, 7042425 - 7042555
Alignment:
| Q |
240 |
cactctttgttgcattaataaactagtgaatgcgctggatattgctaggcgggataccttcatccgggtttgaacctggggcctaacagctgtgtgtatg |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |||||||||| |
|
|
| T |
7042425 |
cactctttgttgcattaataaactagtgaatgcggtggatattgctaggcgggataccttcatccgggttcgaacct-gggcctaacagttgtgtgtatg |
7042523 |
T |
|
| Q |
340 |
agattctggtacttgccacttcgtctgcggac |
371 |
Q |
| |
|
||||||| || ||||||||||||||||||||| |
|
|
| T |
7042524 |
agattctagtgcttgccacttcgtctgcggac |
7042555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 18 - 99
Target Start/End: Original strand, 7042204 - 7042284
Alignment:
| Q |
18 |
tgatgcagtt-aacaattgttagctttctgttttcattggcaacacaaaatcacaatctttactgtgtttctgtttggttgga |
99 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7042204 |
tgatgcagtttaacaattgttagctttctgttttcattggcaacacaaaatcacaatctttac--tgtttctgtttggttgga |
7042284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University