View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_high_68 (Length: 246)
Name: NF6210_high_68
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_high_68 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 144 - 241
Target Start/End: Original strand, 25263482 - 25263579
Alignment:
| Q |
144 |
tggcagctgacttccttgggccgaccctgctactacacaagaggttaatgcacattttctcaaatttttgtcatttaatttgtgtttttatttcttct |
241 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25263482 |
tggcagctgactcctttgggccggccctgctactacataagaggttaatgtacattttctcaaatttttgtcatttaatttgtgtttttatttcttct |
25263579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 7 - 90
Target Start/End: Original strand, 25263394 - 25263477
Alignment:
| Q |
7 |
tatctcttttcttaggggacttttccatatctcttatgcgccctcgtaatttttaaatttaaaaaatacaatgtgctctcaaaa |
90 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
25263394 |
tatctctttttttaggggacttttccatatctcttatgcgccctcgtaatttttaaatttaaaaaacacaatgtgatctcaaaa |
25263477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University