View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_high_69 (Length: 244)
Name: NF6210_high_69
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_high_69 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 21620689 - 21620908
Alignment:
| Q |
1 |
aaaaataagtaaagacaacaaaacaatatgtctaagactgcaaggttttgtctgcgtacaatagaaatagggtaaactattttctgtccaaattaaattt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21620689 |
aaaaataaataaagacaacaaaacaatatgtctaagactgcaaggttttgtctgcgaacaatagaaatagggtaaactattttctgtccaaattaaattt |
21620788 |
T |
 |
| Q |
101 |
tagtgataacaaagaatcaatgtttcctaggcatgcatcatgtttgtctagtgaagcgggggtggttgatttgatgatacatatatttcttagggcatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
21620789 |
tagtgataacaaagaatcaatgtttcctaggcatgcatcatgtttgtctagtgaag-ggaggtgg-----ttgatgatacatacatttcttagggcatgt |
21620882 |
T |
 |
| Q |
201 |
gatggccaccatgtgactatagttgg |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
21620883 |
gatggccaccatgtgactatagttgg |
21620908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University