View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_high_74 (Length: 243)
Name: NF6210_high_74
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_high_74 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 21 - 236
Target Start/End: Complemental strand, 25964292 - 25964077
Alignment:
| Q |
21 |
ggctggtggtgggttcatatctaatacatattgaaaattatatattcaaatcaaatagccccataatagattacaaatacatcaagtttagttgcaaatt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25964292 |
ggctggtggtgggttcatatctaatacatattgaaaattatatattcaaatcaaatagccccaaaatagattacaaatacatcaagtttagttgcaaatt |
25964193 |
T |
|
| Q |
121 |
gagctatcaagtacatgaacatgaatttatcctacaaaatagtttcatatttatatctagtctttgacacgtatttagtctatgacatgtcaaactgtgg |
220 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25964192 |
gagctatcaagtacatgaacatgaatatatcctacaaaatagtttcatatttatatctagtctttgacacgtatttagtctatgacatgtcaaactgtgg |
25964093 |
T |
|
| Q |
221 |
tctcatgtttaatcta |
236 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
25964092 |
tctcatgtttaatcta |
25964077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University