View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_high_76 (Length: 240)
Name: NF6210_high_76
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_high_76 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 11972088 - 11971859
Alignment:
| Q |
1 |
tgaatgctttttgaattattaaatcatatacattgtcaagtgtaaatagtttttgcattattaattataat-------gaccgtcagattattagaaata |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11972088 |
tgaatgctttttgaattattaaatcatatacattgtca-gtgtaaatagtttttgcattattaattataattaagcatgaccgtcagattattagaaata |
11971990 |
T |
|
| Q |
94 |
tt--acttttatcataatcattttggtgagtgtatgaaaattaaactcatgttcatatgcactgtaaagttttgcagttctatcaacttagtgccataac |
191 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11971989 |
tttgacttttatcataatcattttggtgagtgtatgaaaattaaattcatgttcatatgcattgtaaagttttgcagttctatcaacttagtgccataac |
11971890 |
T |
|
| Q |
192 |
aaattaaaaaacacttgttttatgttctctt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
11971889 |
aaattaaaaaacacttgttttatgttctctt |
11971859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University