View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_high_90 (Length: 226)
Name: NF6210_high_90
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_high_90 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 19 - 135
Target Start/End: Complemental strand, 17801633 - 17801516
Alignment:
| Q |
19 |
aattaattgatcatatcattttttcacaagaacatacctcattttttgatagacttaatagattaaggatcatgtattatattata-tttatgcatttca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17801633 |
aattaattgatcatatcattttttcacaagaacatacctcattttttgatagacttaatagattaaggatcatgtattatattatattttatgcatttca |
17801534 |
T |
|
| Q |
118 |
catattattgaagctcca |
135 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
17801533 |
catattattgaagctcca |
17801516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University