View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6210_low_23 (Length: 392)

Name: NF6210_low_23
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6210_low_23
NF6210_low_23
[»] chr5 (2 HSPs)
chr5 (240-371)||(7042425-7042555)
chr5 (18-99)||(7042204-7042284)


Alignment Details
Target: chr5 (Bit Score: 104; Significance: 9e-52; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 240 - 371
Target Start/End: Original strand, 7042425 - 7042555
Alignment:
240 cactctttgttgcattaataaactagtgaatgcgctggatattgctaggcgggataccttcatccgggtttgaacctggggcctaacagctgtgtgtatg 339  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||||||    
7042425 cactctttgttgcattaataaactagtgaatgcggtggatattgctaggcgggataccttcatccgggttcgaacct-gggcctaacagttgtgtgtatg 7042523  T
340 agattctggtacttgccacttcgtctgcggac 371  Q
    ||||||| || |||||||||||||||||||||    
7042524 agattctagtgcttgccacttcgtctgcggac 7042555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 18 - 99
Target Start/End: Original strand, 7042204 - 7042284
Alignment:
18 tgatgcagtt-aacaattgttagctttctgttttcattggcaacacaaaatcacaatctttactgtgtttctgtttggttgga 99  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||    
7042204 tgatgcagtttaacaattgttagctttctgttttcattggcaacacaaaatcacaatctttac--tgtttctgtttggttgga 7042284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University