View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_low_37 (Length: 336)
Name: NF6210_low_37
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_low_37 |
 | |
|
| [»] scaffold0102 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0102 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 324
Target Start/End: Complemental strand, 34301 - 33993
Alignment:
| Q |
18 |
cttttaactttagagatgcaacggtctacatctttgtttgtgttgaggttggagatacagcggtctatatatctacttcttctgaactaggtgttgcagc |
117 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||| ||| |||| |
|
|
| T |
34301 |
cttttgactttagagatgcagcggtctacatctttgtttgtgttgaggttgttgatacagcagtctatatatctgcttcttctgaactaggagttacagc |
34202 |
T |
|
| Q |
118 |
ggtctacatctcctcttttgagataactttttcttctatgcgctttggattcagaactaactctctc--cttcacagcactatcaattgctttactactc |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| || |||||||||||| ||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
34201 |
ggtctacatctcctcttttgagctaactttttcctctgtgggctttggattcacaactaactctctctccttctcagcactatcaattgctttactactc |
34102 |
T |
|
| Q |
216 |
ttgagccctatgacattgatctgctaaatcttattttccttagtagctgcaatctccgtctgactaggtagaaatccagcaggtctttcaaatatagctt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| || |
|
|
| T |
34101 |
ttgagccctatgacattgatctgctaaatcttattttccttagtagctgcaatctccgtctaactaggtagaaacccagcaggtctttcaaatatagttt |
34002 |
T |
|
| Q |
316 |
tgtggattt |
324 |
Q |
| |
|
||||||||| |
|
|
| T |
34001 |
tgtggattt |
33993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University