View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_low_40 (Length: 331)
Name: NF6210_low_40
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 14 - 314
Target Start/End: Complemental strand, 23044299 - 23043999
Alignment:
| Q |
14 |
catcacccctgaagcaaaaatagattcactcaacttctgatgaacaaatacagaatattccaaaaacataatttcgagcatatacaacaagtaacaaaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23044299 |
catcacccctgaagcaaaaatagattcactcaacttctgatgaacaaatacagaatattccaaaaacataatttcgagcatatacaacaagtaacaaaac |
23044200 |
T |
 |
| Q |
114 |
aatttgcaaagtacagacggtataagtttagttatagaagaaaagcagaagtacaaaaaattctgcaagaaattattgactcgtcattcataaatttaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23044199 |
aatttgcaaagtacagacggtataagtttagttatagaagaaaagcagaagtacaaaaaattctgcaagaaattattgactcgtcattcataaatttaaa |
23044100 |
T |
 |
| Q |
214 |
atcaccaagatagaaatagagatagcagctgaacaaaggtatcagcacatttaacaaatcaaaaaggttaagactaaccacgtcggataacaatcaacca |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23044099 |
atcaccaagatagaaatagagatagcagctgaacaaaggtatcagcacatttaacaaatcaaaaaggttaagactaaccacgtcggataacgatcaacca |
23044000 |
T |
 |
| Q |
314 |
c |
314 |
Q |
| |
|
| |
|
|
| T |
23043999 |
c |
23043999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University