View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_low_43 (Length: 321)
Name: NF6210_low_43
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_low_43 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 19 - 314
Target Start/End: Complemental strand, 33592396 - 33592092
Alignment:
| Q |
19 |
taatggtcttgctggtcgtgttgtaaaacatttgtatcgctcttttgttgttaatatatttcattttgccattaatttttgttt---------atatcta |
109 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
33592396 |
taatgctcttgctggtcttgttgtaaaacatttgtatcgctcttttgttgttaatatatttcattttgccattaattttttttttttttttttatatcta |
33592297 |
T |
 |
| Q |
110 |
aataacacggttatatatatgggacattttgatgtgtcatataatttttgataatgattggtacacccatgattaaattatgctttttgttttcatacaa |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33592296 |
aataacacggttatatatataggacattttgatgtgtcatataatttttggtaatgattggtacacccatgattaaattatgctttttgttttcatacaa |
33592197 |
T |
 |
| Q |
210 |
ttgattgcaaaatctgagtacaagagtacacaaaattaacaaccacacacattagtattagtatacagtagttagaataaagacgtaacataactccctt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33592196 |
ttgattgcaaaatctgagtacaagagtacacaaaatttacaaccacacacattagtattagtatacagtagttagaataaagacgtaacataactccctt |
33592097 |
T |
 |
| Q |
310 |
tgcta |
314 |
Q |
| |
|
||||| |
|
|
| T |
33592096 |
tgcta |
33592092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University