View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_low_46 (Length: 311)
Name: NF6210_low_46
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 9 - 240
Target Start/End: Complemental strand, 27715400 - 27715172
Alignment:
| Q |
9 |
gaagaatatgttattggttatgaaagatatcgaatttatccatgtcctaagggaagctaaccatgaggcagatcgtctcgcaaaggaaggatcctcaatg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27715400 |
gaagaatatgttattggttatgaaagatatcgattttatccatgtcctaagggaagctaaccatgaggcagatcgtc----aaaggaaggatcctcaatg |
27715305 |
T |
|
| Q |
109 |
tcaggaagacgagtggtgtggttcctgaattgata-ctgttagtttgtgcagtttttgtttgccggtgttttctgtcatgcgtagtctgtcaagcgcttt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
27715304 |
tcaggaagacgagtggtgtggttcctgaattgatatctgttagtttgtgcagtttttgtttgccggtgttttctgtcatgcgcagtctgtaaagcgcttt |
27715205 |
T |
|
| Q |
208 |
tgtcctggctgttttgagcataggaattcgggt |
240 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| |
|
|
| T |
27715204 |
tgtcctggctgttttgagcattgcaattcgggt |
27715172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 158 - 287
Target Start/End: Original strand, 44753634 - 44753763
Alignment:
| Q |
158 |
agtttttgtttgccggtgttttctgtcatgcgtagtctgtcaagcgcttttgtcctggctgttttgagcataggaattcgggtaggcaaagctgttgtgt |
257 |
Q |
| |
|
||||||||||| || |||||||| |||||| |||||||||||||||||||| || |||||||||||||||||| | |||||||||||||| || | | | |
|
|
| T |
44753634 |
agtttttgtttaccagtgttttcggtcatgtgtagtctgtcaagcgcttttttcttggctgttttgagcatagcagttcgggtaggcaaaactttattat |
44753733 |
T |
|
| Q |
258 |
agggggtgttctgcgcaacattgaaggtgt |
287 |
Q |
| |
|
| |||||||||||||||||| | ||||||| |
|
|
| T |
44753734 |
aaggggtgttctgcgcaacaataaaggtgt |
44753763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University