View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_low_61 (Length: 252)
Name: NF6210_low_61
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_low_61 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 9 - 252
Target Start/End: Original strand, 17801040 - 17801289
Alignment:
| Q |
9 |
tagcataggagagaaaaaccttgtcatgaaaatagatgctt-------gagtcggtccattattttttagtagtaacaaatttgaatttgttttatatat |
101 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17801040 |
tagcatagcaaagaaaaaccttgtcatgaaaatagatgcttaatttatgagtcggtccatcattttttagtagtaacaaatttgaatttgttttatatat |
17801139 |
T |
|
| Q |
102 |
attcatataggttcccaatttgggaattgttttttcttcatcaatttatttggcctggcccctccaagattgtgacgttacgtaacgaaattgacccatc |
201 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17801140 |
attcatataggttcccgatttgggaatt-ttttttcttcatcaatttatttggcctggcccctccaagattgtgacgttacgtaacgaaattgacccatc |
17801238 |
T |
|
| Q |
202 |
cttaattcattgctgtcatcctatgccctagtagaacacatgcatgcatat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17801239 |
cttaattcattgctgtcatcctatgccctagtagaacacatgcatgcatat |
17801289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University