View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_low_62 (Length: 251)
Name: NF6210_low_62
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_low_62 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 132 - 251
Target Start/End: Complemental strand, 11972448 - 11972329
Alignment:
| Q |
132 |
gttctaaacgtgcttcaaagtttcctcctttaccgcttaaaactaatgggtatcatggtgtttcaactgctaaggttcctagaccaggtaagatttttag |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11972448 |
gttctaaacgtgcttcaaagtttcctcctttaccgcttaaaactaatgggtatcatggtgtttcaactgctaaggttcctagaccaggtaagatttttag |
11972349 |
T |
|
| Q |
232 |
aacagaataacgttaattgt |
251 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
11972348 |
aacagaataacgttaattgt |
11972329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 45
Target Start/End: Complemental strand, 11972570 - 11972535
Alignment:
| Q |
10 |
attattctccactatgaacactcaaaccctctccaa |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11972570 |
attattctccactatgaacactcaaaccctctccaa |
11972535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University