View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_low_63 (Length: 251)
Name: NF6210_low_63
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_low_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 35076736 - 35076517
Alignment:
| Q |
1 |
cacgtgtgagctgctacaaaattatggtacggctgataaggaaacattattactgaaaaagtacatcatgaccatgacactt-atgaaattccacactgc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35076736 |
cacgtgtgagctgctacaaaattatggtacggatgataaggaaacattattattgaaaaagtacatcatgaccatgacactttatgaaattcca------ |
35076643 |
T |
 |
| Q |
100 |
tatatactattactagtttagtttacttcaaattttgtatatcgatctagcttgcgacaaatatcttcttctcaaataaaatactatgcatctgcgcacg |
199 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35076642 |
-------tattactaatttagtttacttcaaattttgtatatcgatctagcttgcgacaaatatcttcttctcaaataaaatactatgcatctgcgcacg |
35076550 |
T |
 |
| Q |
200 |
ttctcatgaaaatcagaagccactagtaataaa |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35076549 |
ttctcatgaaaatcagaagccactagtaataaa |
35076517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University