View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_low_64 (Length: 251)
Name: NF6210_low_64
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_low_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 41179489 - 41179247
Alignment:
| Q |
1 |
taattcattagtattgatgcacacagtttagttcaagtttccttttcaataacagttggtttggtattattattgatagtattcattcacctttgaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41179489 |
taattcattagtattgatgcacacagtttagttcaagtttccttttcaataacagttggtttggtattattattgatagtattcattcacctttgaaaat |
41179390 |
T |
 |
| Q |
101 |
tcttgataatcnnnnnnnnnnnncactttgccgtacacctttctcatatatatttactttcttcttcatcaccggttaattt-gtttaggtttggtgcag |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
41179389 |
tcttgataatcatatatat----cactttgccgtacacctttctcatatatatttactttcttcttcatcactggttaattttgtttaggtttggtgcag |
41179294 |
T |
 |
| Q |
200 |
ttgacagtttagaagaaaaacaaaatgcagtcaagtcctttgcttct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41179293 |
ttgacagtttagaagaaaaacaaaatgcagtcaagtcctttgcttct |
41179247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University