View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_low_65 (Length: 249)
Name: NF6210_low_65
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_low_65 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 24634585 - 24634763
Alignment:
| Q |
1 |
tatgtttcaattgtaaacttttataagtaaatttcaaggtttcaacacaaactgtgtatgtgttactgctgggtttaaaatgtaattgtgtttctaattt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24634585 |
tatgtttcaattgtaaacttctataagtaaatttcaaggtttcaacacaaactgtgtatgtgttactgctgggtttaaaatgtaattgtgtttctaattt |
24634684 |
T |
|
| Q |
101 |
tcgacaaatgttggattaatatgtggatcgtcatatgtattattttaatcttgatgtatgaagaaatatctagtatcga |
179 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24634685 |
tcaacaaatgttggattaatatgtggatcgtcatatgtattattttaatcttgatgtatgaagaaatatctagtatcga |
24634763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 24628514 - 24628559
Alignment:
| Q |
1 |
tatgtttc-aattgtaaacttttataagtaaatttcaaggtttcaa |
45 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24628514 |
tatgtttctaattgtaaacttttataagtaaatttcaaggtttcaa |
24628559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 10 - 52
Target Start/End: Complemental strand, 42542372 - 42542330
Alignment:
| Q |
10 |
attgtaaacttttataagtaaatttcaaggtttcaacacaaac |
52 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
42542372 |
attgtaaacatttataagtaaatttcaaggtttcaacagaaac |
42542330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University