View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6210_low_67 (Length: 249)

Name: NF6210_low_67
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6210_low_67
NF6210_low_67
[»] chr5 (1 HSPs)
chr5 (67-249)||(35588819-35589010)


Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 67 - 249
Target Start/End: Original strand, 35588819 - 35589010
Alignment:
67 tgtaaagaaagtatgcagagagcaaattgatagaagtttttgttatgtatattgatgaataaatcacag---------ctgtacaagtattaacagaaaa 157  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||    
35588819 tgtaaagaaagtatgcagagagcaaattgatagaagtttttgttatgtatattgatgaataaatcacaggttaatatactgtacaagtattaacagaaaa 35588918  T
158 accaaactaagaggaagctaaactaatgtataggaaagctaaactaattgataggaacaataaggattaggatgagaacaacaaggatcagt 249  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
35588919 accaaactaagaggaagctgaactaatgtataggaaagctaaactaattgataggaacaataaggattaggatgagaacaacaaggaccagt 35589010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University