View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6210_low_71 (Length: 246)

Name: NF6210_low_71
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6210_low_71
NF6210_low_71
[»] chr7 (2 HSPs)
chr7 (144-241)||(25263482-25263579)
chr7 (7-90)||(25263394-25263477)


Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 144 - 241
Target Start/End: Original strand, 25263482 - 25263579
Alignment:
144 tggcagctgacttccttgggccgaccctgctactacacaagaggttaatgcacattttctcaaatttttgtcatttaatttgtgtttttatttcttct 241  Q
    |||||||||||| | |||||||| ||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
25263482 tggcagctgactcctttgggccggccctgctactacataagaggttaatgtacattttctcaaatttttgtcatttaatttgtgtttttatttcttct 25263579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 7 - 90
Target Start/End: Original strand, 25263394 - 25263477
Alignment:
7 tatctcttttcttaggggacttttccatatctcttatgcgccctcgtaatttttaaatttaaaaaatacaatgtgctctcaaaa 90  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||    
25263394 tatctctttttttaggggacttttccatatctcttatgcgccctcgtaatttttaaatttaaaaaacacaatgtgatctcaaaa 25263477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University