View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_low_74 (Length: 244)
Name: NF6210_low_74
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_low_74 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 4483605 - 4483380
Alignment:
| Q |
19 |
gtggctacatttttgtttctttatataacggttttaactgttatgggtgtgaataaatccagtaataaatgctcctcagttggtgttcagggaattgctt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4483605 |
gtggctacatttttgtttctttatataacggttttaactgtgatgggtgtgaataaatccagtaataaatgctcctcagttggtgttcagggaattgctt |
4483506 |
T |
 |
| Q |
119 |
gggcttttggtggaatgatttttgctcttgtttattgtactgctggtatctcaggtaaaattcacatatcgattgttcaatcaattaggtgcaaaaataa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
4483505 |
gggcttttggtggaatgatttttgctcttgtttattgtactgctggtatctcaggtaaaattcacataccaattgttcaatcaattaggtgcaaaaataa |
4483406 |
T |
 |
| Q |
219 |
tactagtacatgctaaatttaaattt |
244 |
Q |
| |
|
|||| ||||||||||||||||||||| |
|
|
| T |
4483405 |
tactggtacatgctaaatttaaattt |
4483380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 104 - 175
Target Start/End: Complemental strand, 35230916 - 35230845
Alignment:
| Q |
104 |
ttcagggaattgcttgggcttttggtggaatgatttttgctcttgtttattgtactgctggtatctcaggta |
175 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
35230916 |
ttcaaggaattgcttgggcttttggtggcatgatctttgctcttgtttactgtactgctggaatctcaggta |
35230845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 92 - 176
Target Start/End: Complemental strand, 2650167 - 2650083
Alignment:
| Q |
92 |
cctcagttggtgttcagggaattgcttgggcttttggtggaatgatttttgctcttgtttattgtactgctggtatctcaggtaa |
176 |
Q |
| |
|
|||| |||||| |||| ||||||||||||||||||||||| ||||| ||||||||||| ||||| |||||||| || |||||||| |
|
|
| T |
2650167 |
cctctgttggtattcaaggaattgcttgggcttttggtggtatgatctttgctcttgtctattgcactgctggaatttcaggtaa |
2650083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 97 - 175
Target Start/End: Complemental strand, 31460824 - 31460746
Alignment:
| Q |
97 |
gttggtgttcagggaattgcttgggcttttggtggaatgatttttgctcttgtttattgtactgctggtatctcaggta |
175 |
Q |
| |
|
|||||| |||| |||||||||||| |||||||||| ||||| |||||||||||||| ||||| ||||||||||| |||| |
|
|
| T |
31460824 |
gttggtattcaaggaattgcttggtcttttggtggcatgatctttgctcttgtttactgtaccgctggtatctctggta |
31460746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 137
Target Start/End: Complemental strand, 40208111 - 40208071
Alignment:
| Q |
97 |
gttggtgttcagggaattgcttgggcttttggtggaatgat |
137 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
40208111 |
gttggtgttttgggaattgcttgggcttttggtggtatgat |
40208071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University