View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6210_low_75 (Length: 244)

Name: NF6210_low_75
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6210_low_75
NF6210_low_75
[»] chr7 (1 HSPs)
chr7 (1-134)||(42036746-42036879)


Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 42036879 - 42036746
Alignment:
1 tggaggaattaagatatctttacaacataacttgtcaatataaccattttccacagaatgatttgcccaagttcatcaacgttatgaagtggttgaatgg 100  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
42036879 tggaggaattaagatatctttacaacataacttgtaaatataaccattttccacaaaatgatttgcccaagttcatcaacgttatgaagtggttgaatgg 42036780  T
101 tactcaacaaggtaagaaagctatggctgatact 134  Q
    ||||||||||||||||||||||||||||||||||    
42036779 tactcaacaaggtaagaaagctatggctgatact 42036746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University