View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_low_76 (Length: 243)
Name: NF6210_low_76
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_low_76 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 23 - 141
Target Start/End: Complemental strand, 41179762 - 41179644
Alignment:
| Q |
23 |
gtggtaaaagtgagaaggattataaacttgtatttctaaagaaagttgttgatttagagttttgaataatttttaggtaggatagaacacctatataata |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
41179762 |
gtggtaaaagtgagaaggattataaacttgtatttctaaagaaagttgttgatttagagttttgaataatttctaggtaggacagaacacctatataata |
41179663 |
T |
|
| Q |
123 |
agatcttaatcttgttgct |
141 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41179662 |
agatcttaatcttgttgct |
41179644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University