View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_low_84 (Length: 237)
Name: NF6210_low_84
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_low_84 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 9381974 - 9381768
Alignment:
| Q |
1 |
tttattgtaatttaattaatttagtttatacgcaccaacagccaaacataattgttcgatccatggttgactttagtca-atttaacttaaaaaagatga |
99 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9381974 |
tttattgtaatttaaataatttagtttatacgcaccaacagccaaacataattgttcgatccatggttgactttagtcatatttaacttaaaaaagatga |
9381875 |
T |
|
| Q |
100 |
tgtattatgataggttgattgtgtagaatattttacagtaacaatcaaaattattctcttacatcatcttcttatcttatggtatgtgatgatgtttttt |
199 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9381874 |
tgtattgtgataggttgattgtgtagaatattttacagtaacaatcaaaattattctcttatatcatcttcttatcttatggtatgtgatgatgtttttt |
9381775 |
T |
|
| Q |
200 |
ataagat |
206 |
Q |
| |
|
||||||| |
|
|
| T |
9381774 |
ataagat |
9381768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 9399462 - 9399385
Alignment:
| Q |
1 |
tttattgtaatttaattaatttagtttatacgcaccaacagccaaacataattgttcgatccatggttgactttagtca |
79 |
Q |
| |
|
|||||| ||||| ||||| |||| |||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9399462 |
tttattttaattaaatta-tttaatttatatgcaccaacagccaaacataactgttcgatccatggttgactttagtca |
9399385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University