View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6210_low_87 (Length: 236)
Name: NF6210_low_87
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6210_low_87 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 5 - 128
Target Start/End: Original strand, 33110836 - 33110959
Alignment:
| Q |
5 |
gtggagtagcataggctgatatctcagcttttagagaatgtatgtctctttcatgtccttcgacttgctttctctgctggtattggtggccttctctttg |
104 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33110836 |
gtggagtaccagaggctgatatctcagcttttagagaatgtatgtctctttcatgtccttcgacttgctttctctgctggtattggtggccttctctttg |
33110935 |
T |
|
| Q |
105 |
gttatgacactagttagttacttc |
128 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33110936 |
gttatgacactagttagttacttc |
33110959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 57 - 115
Target Start/End: Original strand, 33112558 - 33112616
Alignment:
| Q |
57 |
atgtccttcgacttgctttctctgctggtattggtggccttctctttggttatgacact |
115 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
33112558 |
atgtccttcgtcttgctttttctgctggtattggtggccttctctttggctacgacact |
33112616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 111
Target Start/End: Complemental strand, 21496787 - 21496733
Alignment:
| Q |
57 |
atgtccttcgacttgctttctctgctggtattggtggccttctctttggttatga |
111 |
Q |
| |
|
|||| ||||| |||||||| |||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
21496787 |
atgttcttcgtcttgctttttctgctggaattggtggccttctttttggctatga |
21496733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 111
Target Start/End: Complemental strand, 21562837 - 21562783
Alignment:
| Q |
57 |
atgtccttcgacttgctttctctgctggtattggtggccttctctttggttatga |
111 |
Q |
| |
|
|||| ||||| ||||||||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
21562837 |
atgttcttcgtcttgctttctctgctggaattggtggttttctctttggctatga |
21562783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University