View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6210_low_87 (Length: 236)

Name: NF6210_low_87
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6210_low_87
NF6210_low_87
[»] chr5 (2 HSPs)
chr5 (5-128)||(33110836-33110959)
chr5 (57-115)||(33112558-33112616)
[»] chr2 (2 HSPs)
chr2 (57-111)||(21496733-21496787)
chr2 (57-111)||(21562783-21562837)


Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 5 - 128
Target Start/End: Original strand, 33110836 - 33110959
Alignment:
5 gtggagtagcataggctgatatctcagcttttagagaatgtatgtctctttcatgtccttcgacttgctttctctgctggtattggtggccttctctttg 104  Q
    |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33110836 gtggagtaccagaggctgatatctcagcttttagagaatgtatgtctctttcatgtccttcgacttgctttctctgctggtattggtggccttctctttg 33110935  T
105 gttatgacactagttagttacttc 128  Q
    ||||||||||||||||||||||||    
33110936 gttatgacactagttagttacttc 33110959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 57 - 115
Target Start/End: Original strand, 33112558 - 33112616
Alignment:
57 atgtccttcgacttgctttctctgctggtattggtggccttctctttggttatgacact 115  Q
    |||||||||| |||||||| ||||||||||||||||||||||||||||| || ||||||    
33112558 atgtccttcgtcttgctttttctgctggtattggtggccttctctttggctacgacact 33112616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 111
Target Start/End: Complemental strand, 21496787 - 21496733
Alignment:
57 atgtccttcgacttgctttctctgctggtattggtggccttctctttggttatga 111  Q
    |||| ||||| |||||||| |||||||| |||||||||||||| ||||| |||||    
21496787 atgttcttcgtcttgctttttctgctggaattggtggccttctttttggctatga 21496733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 57 - 111
Target Start/End: Complemental strand, 21562837 - 21562783
Alignment:
57 atgtccttcgacttgctttctctgctggtattggtggccttctctttggttatga 111  Q
    |||| ||||| ||||||||||||||||| ||||||||  |||||||||| |||||    
21562837 atgttcttcgtcttgctttctctgctggaattggtggttttctctttggctatga 21562783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University