View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6210_low_89 (Length: 233)

Name: NF6210_low_89
Description: NF6210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6210_low_89
NF6210_low_89
[»] chr7 (2 HSPs)
chr7 (5-226)||(38883889-38884110)
chr7 (5-222)||(38893081-38893298)
[»] chr3 (1 HSPs)
chr3 (95-208)||(37315993-37316106)
[»] chr1 (1 HSPs)
chr1 (122-216)||(33115133-33115227)


Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 5 - 226
Target Start/End: Original strand, 38883889 - 38884110
Alignment:
5 gatgcctatgatctgttctgtgtatcccttgttacaaagttgctcggtcgcatatactaccacgttgatggtgctgcgaagcccggtacattgcctccca 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38883889 gatgcctatgatctgttctgtgtatcccttgttacaaagttgctcggtcgcatatactaccacgttgatggtgctgcgaagcccggtacattgcctccca 38883988  T
105 atgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcaggaaaaaagtcta 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38883989 atgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcaggaaaaaagtcta 38884088  T
205 tggtatgaccctcatgatgatg 226  Q
    ||||||||||||||||||||||    
38884089 tggtatgaccctcatgatgatg 38884110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 5 - 222
Target Start/End: Original strand, 38893081 - 38893298
Alignment:
5 gatgcctatgatctgttctgtgtatcccttgttacaaagttgctcggtcgcatatactaccacgttgatggtgctgcgaagcccggtacattgcctccca 104  Q
    ||||||||||||||||||||  ||||||||||||| |||||||| || |||||||| ||||| ||||||||||| | |||||||||||||||||| ||||    
38893081 gatgcctatgatctgttctgcatatcccttgttaccaagttgctgggacgcatatattaccatgttgatggtgccgggaagcccggtacattgccaccca 38893180  T
105 atgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcaggaaaaaagtcta 204  Q
    ||||||||||||| || ||||| || ||||||||||| |||||| ||||||| ||||||||||||||||||||||||||| |||| ||||| ||||| ||    
38893181 atgtatcagctgcggttaatggggttgctttctgtggtacacttacagggcagcttttctttggctggcttggtgataagttgggtaggaagaaagtgta 38893280  T
205 tggtatgaccctcatgat 222  Q
    ||||||||| || |||||    
38893281 tggtatgacactgatgat 38893298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 95 - 208
Target Start/End: Complemental strand, 37316106 - 37315993
Alignment:
95 ttgcctcccaatgtatcagctgctgtgaatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcagga 194  Q
    |||||||| ||||||||||| || || |||||||| ||| ||||||| || ||  |||| |||||||||||||| |||||||| || || ||||| || |    
37316106 ttgcctccaaatgtatcagcagcagtaaatggtgttgctctctgtggcactctagcaggccaacttttctttggttggcttggggacaaaatgggaagaa 37316007  T
195 aaaaagtctatggt 208  Q
    ||||||| ||||||    
37316006 aaaaagtttatggt 37315993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 122 - 216
Target Start/End: Original strand, 33115133 - 33115227
Alignment:
122 aatggtgtagctttctgtggaacactttcagggcaacttttctttggctggcttggtgataagatgggcaggaaaaaagtctatggtatgaccct 216  Q
    |||||||| |||||| ||||| ||||  |||| |||||||||||||| ||||||||||| || ||||| || |||  ||| ||||| ||||||||    
33115133 aatggtgttgctttcagtggagcactggcaggacaacttttctttggttggcttggtgacaaaatgggaagaaaacgagtttatggaatgaccct 33115227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University