View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6211_high_17 (Length: 304)
Name: NF6211_high_17
Description: NF6211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6211_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 13 - 186
Target Start/End: Original strand, 41277656 - 41277829
Alignment:
| Q |
13 |
aatatcggtacggttgcattcattctcttggctacaatcaacactttcaatcggaatcgacaacgaagaagcctctcctccttcaattctgcggcgtttg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277656 |
aatatcggtacggttgcattcattctcttggctacaatcaacactttcaatcggaatcgacaacgaagaagcctctcctccttcaattctgcggcgtttg |
41277755 |
T |
 |
| Q |
113 |
tttatctcgtcgccgggaataacacttacttcgtcggatcgggaaaccctagacgacggcacatcgggaacata |
186 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41277756 |
tttctctcgtcgccgggaataacacttacttcgtcggatcgggaaaccctagacgacggcacatcgggaacata |
41277829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 236 - 283
Target Start/End: Original strand, 41277879 - 41277926
Alignment:
| Q |
236 |
ccggagtggccgtttagtactaaattgatgaatctgggatctgctccg |
283 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
41277879 |
ccggagtggccgtttaggactaaattaatgaatctgggatctgctccg |
41277926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University