View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6211_high_7 (Length: 445)
Name: NF6211_high_7
Description: NF6211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6211_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 415; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 415; E-Value: 0
Query Start/End: Original strand, 1 - 439
Target Start/End: Original strand, 39403368 - 39403806
Alignment:
| Q |
1 |
atcaccaatttacgattcatttcaaaatgacattaatagaaaatattaatcaattattaaaactttataattaaactatgattaaagttaaaatgttttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39403368 |
atcaccaatttacgattcatttcaaaatgacattaatagcaaatattaatcaattattaaaactttataattaaactatgattaaagttaaaatgttttt |
39403467 |
T |
 |
| Q |
101 |
aatgatctgtaggtggcaaacgagagagccctccctgttggacccgaggaaggcggttttgggatgtcatatgatcttctatatggacgagctggattcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39403468 |
aatgatctgtaggtggcaaacgagagagccctccctgttggacccgaggaaggcggttttgggatgtcatatgatcttctatacggacgagctggattcc |
39403567 |
T |
 |
| Q |
201 |
tatgggctgcattgttcctaaacaagcacctaggagaagatacggtgtccaaagacattctaatgcctattattgatgcagtattggccggcggtagagc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39403568 |
tatgggctgcattgttcctaaacaagcacctaggagaagatacggtgtccaaagacattctaatgcctattattgatgcagtactggccggcggtagagc |
39403667 |
T |
 |
| Q |
301 |
aggagcgtctgatatcaaagactgtccattgatgtatagatggcatgggacaaggtacttaggtgcagcaaatggccttgctggtattcttcatgtgctc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39403668 |
aggagcgtctgatatcaaagactgtccattgatgtatagatggcatgggacaaggtacttaggtgcagcaaatggccttgctggtattcttcatgtgctc |
39403767 |
T |
 |
| Q |
401 |
cttcattttccacttccaagtgaatatgttgatgatgtc |
439 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
39403768 |
attcattttccacttccaagtgaatatgctgaagatgtc |
39403806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University