View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6211_low_20 (Length: 252)
Name: NF6211_low_20
Description: NF6211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6211_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 37583118 - 37582866
Alignment:
| Q |
1 |
ttttgcaaatgcatagcatgtatatgtacccttattatgttttcttgtatattcattcatttattgcaacattattatctttacaaggttgagtc---nn |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37583118 |
ttttgcaaatgcatagcatgtatatgtacccttattatgttttcttgtatattcattcatttattgcaacattattatctttacaaggttgagtcttttt |
37583019 |
T |
 |
| Q |
98 |
nnnnnnnnctgttgannnnnnncatatgtaaaagtcgatcatggtaaccaaaatttacaacacaggctgcacatcaaacacttacactctagtcattttt |
197 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37583018 |
ttttttttctgttgatttttttcatatgtaaaagtcgatcatggtaaccaaaatttacaacacaggctgcacatcaaacacttacactctagtcattttt |
37582919 |
T |
 |
| Q |
198 |
ctgttgac-nnnnnnnnnggtggtagtatattttgttgcctctctgctcctcc |
249 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| | ||||||| |
|
|
| T |
37582918 |
ctgttgacttttttttttggtggtagtatattttgttgcctctttactcctcc |
37582866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University