View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6211_low_22 (Length: 238)
Name: NF6211_low_22
Description: NF6211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6211_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 205
Target Start/End: Complemental strand, 6950555 - 6950369
Alignment:
| Q |
19 |
atgtggggtatttttactagaggtagggcaaggtaaaaggcagtattggcaggtttggtttggtgtgttgtactactcaatattgcagtgttgcagtctg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6950555 |
atgtggggtatttttactagaggtagggcaaggtaaaaggcagtattggcaggtttggtttggtgtgttgtactactcaatattgcagtgttgcagtctg |
6950456 |
T |
|
| Q |
119 |
accaattgtgttgttttgtgttatgttgttgcttgcttgcatggttcggcgtcctctcttcacttatcacacaagtgggtacttgtc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6950455 |
accaattgtgttgttttgtgttatgttgttgcttgcttgcatggttcggcgtcctctcttcacttatcacacaagtgggtacttgtc |
6950369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University