View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6211_low_27 (Length: 224)
Name: NF6211_low_27
Description: NF6211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6211_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 1790936 - 1790744
Alignment:
| Q |
19 |
acctcacccttcttcatactcattacagctctatcaagccctctagtcacttgcgctgctcaacacaacagacattcactttcgttggttagtataaaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1790936 |
acctcacccttcttcatactcattacagctctatcaagccctctagtcacttgcgctgctcaacacaacagacattcactttcgttggttagtataaaaa |
1790837 |
T |
 |
| Q |
119 |
caaattaataggagagagtgaaccaatgcaacaatttaagataatcaccctcaccttcgtctgttgtgaattcaaacagctctgcttcatctc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1790836 |
caaattaataggagagagtgaaccaatgcaacaatttaagataatcaccctcaccttcgtctgttgtgaattcaaacagctctgcttcatctc |
1790744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 99
Target Start/End: Original strand, 3495239 - 3495319
Alignment:
| Q |
19 |
acctcacccttcttcatactcattacagctctatcaagccctctagtcacttgcgctgctcaacacaacagacattcactt |
99 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||| | |||||||| |||||||| |||||| |||||||||| |
|
|
| T |
3495239 |
acctcacccttcttcatggtcattacagctctatcgagcccatcaatcacttgctctgctcaatacaacaaacattcactt |
3495319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 99
Target Start/End: Original strand, 14388833 - 14388913
Alignment:
| Q |
19 |
acctcacccttcttcatactcattacagctctatcaagccctctagtcacttgcgctgctcaacacaacagacattcactt |
99 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||| ||||| | |||||||| |||||||| |||||| |||||||||| |
|
|
| T |
14388833 |
acctcacccttcttcatggtcattacagctttatcgagcccatcaatcacttgctctgctcaatacaacaaacattcactt |
14388913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 175 - 209
Target Start/End: Original strand, 3495389 - 3495423
Alignment:
| Q |
175 |
tcgtctgttgtgaattcaaacagctctgcttcatc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3495389 |
tcgtctgttgtgaattcaaacagctctgcttcatc |
3495423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 3500390 - 3500431
Alignment:
| Q |
19 |
acctcacccttcttcatactcattacagctctatcaagccct |
60 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3500390 |
acctcacccttcttcatggtcattacagctctatcaagccct |
3500431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 2795031 - 2794945
Alignment:
| Q |
19 |
acctcacccttcttcatactcattacagctctatcaagccctctagtcacttgcgctgctcaacacaacagacattcactttcgttg |
105 |
Q |
| |
|
||||||||||||||||| ||| ||||||| |||||||||| | |||||||| |||||||| |||| | |||||||||| |||| |
|
|
| T |
2795031 |
acctcacccttcttcatggtcagtacagctttatcaagcccatcaatcacttgctctgctcaatacaaaaagcattcactttagttg |
2794945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 2876685 - 2876771
Alignment:
| Q |
19 |
acctcacccttcttcatactcattacagctctatcaagccctctagtcacttgcgctgctcaacacaacagacattcactttcgttg |
105 |
Q |
| |
|
|||||| |||||||||| ||| |||||||||||||||||| | |||||||| |||||||| |||| | |||||||||| |||| |
|
|
| T |
2876685 |
acctcatccttcttcatggtcagtacagctctatcaagcccatcaatcacttgctctgctcaatacaaaaagcattcactttagttg |
2876771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 2891133 - 2891214
Alignment:
| Q |
19 |
acctcacccttcttcatactcattacagctctatcaagccctctagtcacttgcgctgctcaacacaacagacattcacttt |
100 |
Q |
| |
|
||||||||||||||||| ||| ||||||| |||||||||| | |||||||| |||||||| |||| | |||||||||| |
|
|
| T |
2891133 |
acctcacccttcttcatggtcagtacagctttatcaagcccatcaatcacttgctctgctcaatacaaaaagcattcacttt |
2891214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 18847772 - 18847812
Alignment:
| Q |
19 |
acctcacccttcttcatactcattacagctctatcaagccc |
59 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| |||||||||| |
|
|
| T |
18847772 |
acctcacccttcttcatagtcaatacagctttatcaagccc |
18847812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University