View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6212_low_8 (Length: 211)
Name: NF6212_low_8
Description: NF6212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6212_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 5 - 72
Target Start/End: Complemental strand, 3958749 - 3958682
Alignment:
| Q |
5 |
ggatgtcgaagaatatactagagaatccatatatttaatgtcttaagattttggactaagatatgatg |
72 |
Q |
| |
|
|||||| ||| || ||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
3958749 |
ggatgttgaacaacatactagagaatccatatatttaatgtcttaagattttggattaaaatatgatg |
3958682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 5 - 68
Target Start/End: Original strand, 14002084 - 14002147
Alignment:
| Q |
5 |
ggatgtcgaagaatatactagagaatccatatatttaatgtcttaagattttggactaagatat |
68 |
Q |
| |
|
|||||| ||| || |||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14002084 |
ggatgttgaacaacatactagagaattcatatatttaatgtcttaagattttggattaagatat |
14002147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 73
Target Start/End: Original strand, 11307241 - 11307285
Alignment:
| Q |
29 |
atccatatatttaatgtcttaagattttggactaagatatgatgt |
73 |
Q |
| |
|
||||||| |||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
11307241 |
atccatacatttgatgtcttaagattttggattaagatatgatgt |
11307285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University