View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6213_high_12 (Length: 329)
Name: NF6213_high_12
Description: NF6213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6213_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 14 - 328
Target Start/End: Complemental strand, 46126399 - 46126087
Alignment:
| Q |
14 |
atatactccatatagtatgaataatatcagtgttcataacctgctgcacaagtttgctccctattcccagacggccaagaagcaaggaaagatagctagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46126399 |
atatactccatatagtatgaataatatcagtgttcataacctgctgcacaagtttgctccctattcccagacggccaagaagcaaggaaagatagctagt |
46126300 |
T |
 |
| Q |
114 |
gaggtcaagctgctgctttgtgcccttcatgagccagtcttaaagctgacaagtaatagcacaatcaagaaagacatgatgagcagtttcagcagtctta |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46126299 |
gaggtcaagctgctgctttgtgcccttcatgagccagtcttaaagctgacaagtaatagcacaatcaagaaagacatgatgagcagtttcagcagtcttg |
46126200 |
T |
 |
| Q |
214 |
ttgcagaagcagcaaatggagactatgatgcaacccctttttcttaaaaattctcatcggtggggagtttattctgaagcaatctccaagtgatgaaggc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46126199 |
ttgcagaagcagcaaatggagactatgatgcaacccctttttctt--aaattctcatcagtggggagtttattctgaagcaatctccaagtaatgaaggc |
46126102 |
T |
 |
| Q |
314 |
acgagtaggaggaat |
328 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46126101 |
acgagtaggaggaat |
46126087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University