View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6213_low_11 (Length: 355)
Name: NF6213_low_11
Description: NF6213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6213_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 32092193 - 32092337
Alignment:
| Q |
1 |
tcatcagtatctctccttccaccatttgagtctcaagatagcaacgcaacgcaacgcaacaagcatgtcaacaactacatcaatagccagccttaaacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32092193 |
tcatcagtatctctccttccaccatttgagtctcaagatagcaa-----cgcaacgcaacaagcatgtcaacaactacatcaatagccagcctgaaacta |
32092287 |
T |
|
| Q |
101 |
tggttcatcctctctgaatccaaacgaatcatcaacgctcactcccgtca |
150 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32092288 |
tggtccatcctctctgaatccaaacgaatcatcaacgctcactcccgtca |
32092337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 265 - 355
Target Start/End: Original strand, 32092452 - 32092545
Alignment:
| Q |
265 |
tcttcgtcaagcaacgtctttacggtctctgcagttgcgcacagaa---gatatcagatttacacctaaaacaaccacttctcttgatttacct |
355 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32092452 |
tcttcgtcaagcaacgtctctactgtctctgcagttgcgcacagaagaagatatcaggtttacacctaaaacaaccacttctcttgatttacct |
32092545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University