View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6213_low_2 (Length: 596)
Name: NF6213_low_2
Description: NF6213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6213_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 561; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 561; E-Value: 0
Query Start/End: Original strand, 15 - 579
Target Start/End: Original strand, 13212421 - 13212985
Alignment:
| Q |
15 |
ttcactggtgtttcttcatcttctaaaggtagcctttcataagcagcatttccaaaggaagctgccatgataacaaccggaccggaagctaacaacggtc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212421 |
ttcactggtgtttcttcatcttctaaaggtagcctttcataagcagcatttccaaaggaagctgccatgataacaaccggaccggaagctaacaacggtc |
13212520 |
T |
 |
| Q |
115 |
ccaccacgctaccaccgacgacctgtccttgtccaccagctagatatatggctaatcctgacgccgctggtggagcaggcggcggcaggaaagagccaga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212521 |
ccaccacgctaccaccgacgacctgtccttgtccaccagctagatatatggctaatcctgacgccgctggtggagcaggcggcggcaggaaagagccaga |
13212620 |
T |
 |
| Q |
215 |
taatgataatatctcaaatcttccatgaagtgtgactaccgcaccaggcgatgctggttgacggagagtcacgtttgtgacggtcccacttccgctaagg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212621 |
taatgataatatctcaaatcttccatgaagtgtgactaccgcaccaggcgatgctggttgacggagagtcacgtttgtgacggtcccacttccgctaagg |
13212720 |
T |
 |
| Q |
315 |
atgcagacaccacgctgcctccttcgcgcaaagaccgtcacactttccatgatgtcacatccatttgcaacttccatcacgtgggatcggagtgcgttcg |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212721 |
atgcagacaccacgctgcctccttcgcgcaaagaccgtcacactttccatgatgtcacatccatttgcaacttccatcacgtgggatcggagtgcgttcg |
13212820 |
T |
 |
| Q |
415 |
cgctgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttcttcccatctcaccaccacttcctccacc |
514 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212821 |
cgctgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttcttcccatctcaccaccacttcctccacc |
13212920 |
T |
 |
| Q |
515 |
agcacttccgctaccgccgtcgtcttttccttctcctccggtgggagtgttgttgccgtcttcgt |
579 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212921 |
agcacttccgctaccaccgtcgtcttttccttctcctccggtgggagtgttgttgccgtcttcgt |
13212985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 408 - 488
Target Start/End: Original strand, 3332356 - 3332436
Alignment:
| Q |
408 |
gcgttcgcgctgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttctt |
488 |
Q |
| |
|
||||| |||||||| | |||||||| || |||||||||||||||||||| || || |||||||||||||||||||||||| |
|
|
| T |
3332356 |
gcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctcttggtcttctt |
3332436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 438 - 486
Target Start/End: Complemental strand, 16578665 - 16578617
Alignment:
| Q |
438 |
ggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttc |
486 |
Q |
| |
|
|||||||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
16578665 |
ggtggttttggtttgttttttgaaccgggtggtcttcctcttggtcttc |
16578617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 434 - 486
Target Start/End: Original strand, 32803226 - 32803278
Alignment:
| Q |
434 |
gataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttc |
486 |
Q |
| |
|
|||||||||||||||| ||||||| || || | |||||||||||||||||||| |
|
|
| T |
32803226 |
gataggtggttttggtctgtttttggatccaggtggtcttcctcttggtcttc |
32803278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 420 - 457
Target Start/End: Complemental strand, 46200969 - 46200932
Alignment:
| Q |
420 |
tccctcgtgatgatgataggtggttttggtttgttttt |
457 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
46200969 |
tcccttgtgatgataataggtggttttggtttgttttt |
46200932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University