View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6213_low_20 (Length: 249)
Name: NF6213_low_20
Description: NF6213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6213_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 7472225 - 7471985
Alignment:
| Q |
1 |
attaaattgtttattcaaacagggtctattataatcaaattattactannnnnnnnnncttt------caggactccatatgttcaagaacaggttaata |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7472225 |
attaaattgtttattcaaacagggtctattataatcaaattattactattttttttttttttttttgtcaggactccatatgttcaagaacaggttaata |
7472126 |
T |
|
| Q |
95 |
taggctctggtccacctgattcaagagtgaggtggtttcgttcatctagcaatgaaccgcggtttattaacacagttacttttgacagtaaagatgattc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7472125 |
taggctctggtccacctgattcaagagtgaggtggtttcgttcatctagcaatgaaccgcggtttattaacacagttacttttgacagtaaagatgattc |
7472026 |
T |
|
| Q |
195 |
tcctacattggtaatggttcacggatatgctgcatcacagg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7472025 |
tcctacattggtaatggttcacggatatgctgcatcacagg |
7471985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University