View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6213_low_29 (Length: 235)
Name: NF6213_low_29
Description: NF6213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6213_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 70 - 222
Target Start/End: Original strand, 44756576 - 44756732
Alignment:
| Q |
70 |
ttctttcagtttgctcatagagattgcatacaaagatggtgtaacgagaaaggaaatacaacctgtgaaatatgtctccag----gtatgtatgtatgat |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44756576 |
ttctttcagtttgctcatagagattgcatacaaagatggtgtaacgagaaaggaaatacaacctgtgaaatatgtctccaggtatgtatgtatgtatgat |
44756675 |
T |
 |
| Q |
166 |
gattaataacgttgttttcattttctgttttagtaagttgtgatcaaacttgatttt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44756676 |
gattaataacgttgttttcattttctgttttagtaagttgtgatcaaacttgatttt |
44756732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 77 - 155
Target Start/End: Complemental strand, 39043666 - 39043588
Alignment:
| Q |
77 |
agtttgctcatagagattgcatacaaagatggtgtaacgagaaaggaaatacaacctgtgaaatatgtctccaggtatg |
155 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||| || || |||||||||||||| |||||||| ||||| |||||||| |
|
|
| T |
39043666 |
agtttgctcatagagattgcattcaaacatggtgcaatgaaaaaggaaatacaacttgtgaaatttgtctacaggtatg |
39043588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University