View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6213_low_30 (Length: 234)
Name: NF6213_low_30
Description: NF6213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6213_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 5 - 224
Target Start/End: Complemental strand, 31622972 - 31622753
Alignment:
| Q |
5 |
cacgaagccaaccgcgtcttctcccactgtccccctcgcttctggagctacttccgctctaaagacggcggagcccaacgaaattctcttcgtcactggt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31622972 |
cacgaagccaaccgcgtcttctcccactgtccccctttcttctggagttacttccgctctaaagacggcggagcccaacgaaattgtcttcgtcactggt |
31622873 |
T |
 |
| Q |
105 |
cagtctttcccttcactatttaataaagcataattgctaattcctctttattgtaatgtaaactgtaaattgaatgcgtatgttttaatattgttgttga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31622872 |
cagtctttcccttcactatttaataaagcataattgctaattcctctttattgtaatgtaaactgtaaattaaatgcgtatgttttaatattgttgttga |
31622773 |
T |
 |
| Q |
205 |
ggttttatttcatgtatatg |
224 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
31622772 |
ggttttatttcatgtatatg |
31622753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University