View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6213_low_35 (Length: 202)

Name: NF6213_low_35
Description: NF6213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6213_low_35
NF6213_low_35
[»] chr4 (1 HSPs)
chr4 (1-202)||(44905786-44905987)


Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 44905786 - 44905987
Alignment:
1 tttgcatctaggtcccctatgctgctttaacttggtggtagtcactactccagatgtttgagagcagtgacaaagttaatgactacacaaattaacaaca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44905786 tttgcatctaggtcccctatgctgctttaacttggtggtagtcactactccagatgtttgagagcagtgacaaagttaatgactacacaaattaacaaca 44905885  T
101 aaaatgatagataattgcatattatcatgtctaatggaatggtgacccgagccaaccaacttagataaatgagttaatactttgaatcacccatctacaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44905886 aaaatgatagataattgcatattatcatgtctaatggaatggtgacccgagccaaccaacttagataaatgagttaatactttgaatcacccatctacaa 44905985  T
201 gt 202  Q
    ||    
44905986 gt 44905987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University