View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6214_low_7 (Length: 242)
Name: NF6214_low_7
Description: NF6214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6214_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 59 - 225
Target Start/End: Original strand, 32591432 - 32591603
Alignment:
| Q |
59 |
aaagttgagggtaattttggaagnnnnnnnccaatagataacatacta-----taatacaagttacatatatctagttannnnnnncccttnnnnnnnnt |
153 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||||||||||||| ||||||||||||||||||| |||||| ||||| | |
|
|
| T |
32591432 |
aaagttgaaggtaatttcggaagaaaaaaaccaatagataacatactacagtataatacaagttacatatatttagttatttttttcccttaaaaaaaat |
32591531 |
T |
 |
| Q |
154 |
tatattttttggaagggtagttacgaataacggttttttctcaacaaaaaacaagaaaagcaaataacaact |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32591532 |
tatattttttggaagggtagttacgaataacggttttttctcaacaaaaaacaagaaaagcaaataacaact |
32591603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University