View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6216_high_26 (Length: 238)
Name: NF6216_high_26
Description: NF6216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6216_high_26 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 34624888 - 34624667
Alignment:
| Q |
17 |
atgaatcaaaaaatttcgagtagcatgaacatatctcaccaagatggtttctaaattgatcggtcccttgaaactatactaagcaaatgtatagaacata |
116 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34624888 |
atgaataaaaaattttcgagtagcatgaacatatctcaccaagatggtttctaaattgatcggtcccttgaaactatactaagcaaatgtatagaacata |
34624789 |
T |
 |
| Q |
117 |
gttttcatatcgttattgttttgaagtttcatctttgtgaacctaacacgcccatatgagtcgattgacaaaaaatgatactcatcacagactgcccttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34624788 |
gttttcatatcgttattgttttgaagtttcatctttgtgaacctaacacgcccatatgagtcgattgacaaaaaatgatactcatcacagactacccttt |
34624689 |
T |
 |
| Q |
217 |
ttgtatcactgtagatgagaat |
238 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
34624688 |
ttgtatcaccgtagatgagaat |
34624667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 88 - 148
Target Start/End: Original strand, 34554045 - 34554105
Alignment:
| Q |
88 |
aactatactaagcaaatgtatagaacatagttttcatatcgttattgttttgaagtttcat |
148 |
Q |
| |
|
||||||||| | ||||| || | ||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
34554045 |
aactatactcaacaaatatagataacatagttttcacatcgttgttgttttgaagtttcat |
34554105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University