View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6216_low_11 (Length: 353)
Name: NF6216_low_11
Description: NF6216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6216_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 2e-62; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 16 - 157
Target Start/End: Complemental strand, 49096993 - 49096853
Alignment:
| Q |
16 |
ggtgaaggtgaaggtgaaggtgaaggtggggcaagagacttgttgaagtagtatgaacaggcagacaattattggacccacacggacacacgcgtctgga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49096993 |
ggtgaaggtgaaggtgaaggtgaaggtggggctagagacttgttgaagtagtatgaacaggcagacaattattggacccacacggacacacgcgtctgga |
49096894 |
T |
|
| Q |
116 |
tttattcatttcacgacgaaatttcagcctcagtgtgacaac |
157 |
Q |
| |
|
|||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
49096893 |
tttattca-ttgacgacgatatttcagcctcagtgtgacaac |
49096853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 233 - 353
Target Start/End: Complemental strand, 49096787 - 49096667
Alignment:
| Q |
233 |
ataacattgcatttggcatttgcaccttcttcccattttctcaccactagagtgtataacgcaacgcgcatttccaaagtctcataattccattttccag |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49096787 |
ataacattgcatttggcatttgcaccttcttcccattttctcaccactagagtgtataacgcaacgcgcatttccaaagtctcataattccattttccag |
49096688 |
T |
|
| Q |
333 |
cacagacacacaccggtcaac |
353 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
49096687 |
cacagacacacaccggtcaac |
49096667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 11 - 43
Target Start/End: Complemental strand, 49097004 - 49096972
Alignment:
| Q |
11 |
caaagggtgaaggtgaaggtgaaggtgaaggtg |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49097004 |
caaagggtgaaggtgaaggtgaaggtgaaggtg |
49096972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University