View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6216_low_15 (Length: 288)
Name: NF6216_low_15
Description: NF6216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6216_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 57 - 282
Target Start/End: Complemental strand, 30213710 - 30213489
Alignment:
| Q |
57 |
cttccaatactggaaataagaggatacaaagtacatatcatacgaccagatcgggataacaagcacaaccatgatgatataaagatctttggtgaaaatt |
156 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
30213710 |
cttccaatactagaaataagaggatacaaagtacatatcatacaaccagatcggaataacaagcacaaccgtgatgatatgaagatctttggtgaaaatt |
30213611 |
T |
 |
| Q |
157 |
gttagtactctctatagtaaatcaaaatcatagatagaaatatattatctatcataatgttaaaacatagctaaacaatgtgtacctgacataatatgac |
256 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||||| | ||| |
|
|
| T |
30213610 |
gttagtactc----tagtaaatcaaaatcatggatagtaatatattatctatcataatgttaaaacgttgctaaacaatgtgtacctgacatgacatgga |
30213515 |
T |
 |
| Q |
257 |
tgtttttattgacttcatagaatctt |
282 |
Q |
| |
|
||| |||||||||||| |||||||| |
|
|
| T |
30213514 |
tgtgtttattgacttcggagaatctt |
30213489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University