View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6216_low_21 (Length: 254)
Name: NF6216_low_21
Description: NF6216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6216_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 35973775 - 35973532
Alignment:
| Q |
1 |
tttccactagatcgccgacagttgattccggcttcatcagcatctgaacgggaccaaggcttccaagaaccgtcactttcaaaagcaacttcggtggttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35973775 |
tttccactagatcgccgacagttgattccggtttcatcagcatctgaataggaccaaggcttccaagaaccgtcactttcaaaagcaacttcggtggttg |
35973676 |
T |
 |
| Q |
101 |
tctaggaagaccttccgtcaccggaaggacgttgttccggtaagatagaagatcaggaacggtttttggacggcgaattgtagcagtggtcgtcataacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35973675 |
tctaggaagaccttccgtcaccggaaggacgttgttccggtaagatagaagatcaggaacggtttttggacggcgaattgtagcagtggtcgtcataacg |
35973576 |
T |
 |
| Q |
201 |
ttgtttccgtgaaaagatgaagatctgtcgctcaaccttctctg |
244 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35973575 |
ttgtttccgtgaaaagatgaagatctctcgctcaaccttctctg |
35973532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University