View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6216_low_29 (Length: 237)
Name: NF6216_low_29
Description: NF6216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6216_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 91 - 209
Target Start/End: Original strand, 26496226 - 26496346
Alignment:
| Q |
91 |
tgtttgcaagagctgtctgaatcaggaagcaatttattcaaagttgttagg--atgaaaggatcacatatggtcttattttaggttttcattataaaatt |
188 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| || |||| |||||||||| |||| |||||||||| |||||||||| ||||||||| |
|
|
| T |
26496226 |
tgtttgcaggagctgtctgaatcaggaagcaatttattcaaagctgataggggatgaaaggattacatttggtcttattctaggttttcactataaaatt |
26496325 |
T |
 |
| Q |
189 |
gatgataatcttgattttggt |
209 |
Q |
| |
|
| ||||||||||||| |||| |
|
|
| T |
26496326 |
ggggataatcttgattctggt |
26496346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 16 - 80
Target Start/End: Original strand, 26496172 - 26496236
Alignment:
| Q |
16 |
atgtgactcttttgcttttgtttctcttggtttttggatagtaaaattaaaggatgtttgcagga |
80 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26496172 |
atgtgactctttttcttttgtttgttttggtttttggatagtaaaattaaaggatgtttgcagga |
26496236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 16 - 80
Target Start/End: Original strand, 47521381 - 47521445
Alignment:
| Q |
16 |
atgtgactcttttgcttttgtttctcttggtttttggatagtaaaattaaaggatgtttgcagga |
80 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47521381 |
atgtgactcttttgcttttgtttcttttggttattggatagtaaaattaaaggatgtttgcagga |
47521445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 153 - 217
Target Start/End: Original strand, 47521508 - 47521572
Alignment:
| Q |
153 |
acatatggtcttattttaggttttcattataaaattgatgataatcttgattttggtgtagattt |
217 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
47521508 |
acatatggtcttattctaggttttcattataaaattggtgataatcttgattctggtgtagattt |
47521572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 91 - 136
Target Start/End: Original strand, 47521435 - 47521480
Alignment:
| Q |
91 |
tgtttgcaagagctgtctgaatcaggaagcaatttattcaaagttg |
136 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47521435 |
tgtttgcaggagctgtctgaatcaggaagcaatttattcaaagttg |
47521480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 51; Significance: 2e-20; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 16 - 78
Target Start/End: Original strand, 4092119 - 4092181
Alignment:
| Q |
16 |
atgtgactcttttgcttttgtttctcttggtttttggatagtaaaattaaaggatgtttgcag |
78 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4092119 |
atgtgtctcttttgcttttgtttcttttggttattggatagtaaaattaaaggatgtttgcag |
4092181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 153 - 217
Target Start/End: Original strand, 4092246 - 4092310
Alignment:
| Q |
153 |
acatatggtcttattttaggttttcattataaaattgatgataatcttgattttggtgtagattt |
217 |
Q |
| |
|
|||| |||||||||| |||||||||||||| |||||| |||||||||||||| |||||||||||| |
|
|
| T |
4092246 |
acatctggtcttattctaggttttcattatgaaattggtgataatcttgattctggtgtagattt |
4092310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 16 - 80
Target Start/End: Original strand, 4435897 - 4435961
Alignment:
| Q |
16 |
atgtgactcttttgcttttgtttctcttggtttttggatagtaaaattaaaggatgtttgcagga |
80 |
Q |
| |
|
|||||| | ||||||||| |||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4435897 |
atgtgatttttttgctttcgtttcttttggttattggatagtaaaattaaaggatgtttgcagga |
4435961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 159 - 217
Target Start/End: Original strand, 4436030 - 4436088
Alignment:
| Q |
159 |
ggtcttattttaggttttcattataaaattgatgataatcttgattttggtgtagattt |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||| || ||||||||| |
|
|
| T |
4436030 |
ggtcttattctaggttttcattataaaattggtgataatcttgattctgatgtagattt |
4436088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 91 - 133
Target Start/End: Original strand, 4435951 - 4435993
Alignment:
| Q |
91 |
tgtttgcaagagctgtctgaatcaggaagcaatttattcaaag |
133 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4435951 |
tgtttgcaggagctgtctgaatcaggaagcaatttattcaaag |
4435993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 131
Target Start/End: Original strand, 4092173 - 4092213
Alignment:
| Q |
91 |
tgtttgcaagagctgtctgaatcaggaagcaatttattcaa |
131 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
4092173 |
tgtttgcagtagctgtctaaatcaggaagcaatttattcaa |
4092213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 4e-19; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 37719261 - 37719197
Alignment:
| Q |
16 |
atgtgactcttttgcttttgtttctcttggtttttggatagtaaaattaaaggatgtttgcagga |
80 |
Q |
| |
|
|||||| | |||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37719261 |
atgtgatttttttgcttttgtttcttttggttattggatagtaaaattaaaggatgtttgcagga |
37719197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 159 - 217
Target Start/End: Complemental strand, 37719128 - 37719070
Alignment:
| Q |
159 |
ggtcttattttaggttttcattataaaattgatgataatcttgattttggtgtagattt |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
37719128 |
ggtcttattctaggttttcattataaaattggtgataatcttgattctggtgtagattt |
37719070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 91 - 133
Target Start/End: Complemental strand, 37719207 - 37719165
Alignment:
| Q |
91 |
tgtttgcaagagctgtctgaatcaggaagcaatttattcaaag |
133 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37719207 |
tgtttgcaggagctgtctgaatcaggaagcaatttattcaaag |
37719165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 153 - 217
Target Start/End: Complemental strand, 30440552 - 30440488
Alignment:
| Q |
153 |
acatatggtcttattttaggttttcattataaaattgatgataatcttgattttggtgtagattt |
217 |
Q |
| |
|
|||| ||||||| || |||||||||| ||||| |||| |||||||||||||| |||||||||||| |
|
|
| T |
30440552 |
acatctggtctttttctaggttttcactataacattggtgataatcttgattctggtgtagattt |
30440488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 159 - 217
Target Start/End: Complemental strand, 46594808 - 46594750
Alignment:
| Q |
159 |
ggtcttattttaggttttcattataaaattgatgataatcttgattttggtgtagattt |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
46594808 |
ggtcttattctaggttttcattataaaattggtgataatcttgattctggtgtagattt |
46594750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 46594941 - 46594877
Alignment:
| Q |
16 |
atgtgactcttttgcttttgtttctcttggtttttggatagtaaaattaaaggatgtttgcagga |
80 |
Q |
| |
|
|||||| | ||||||||| |||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46594941 |
atgtgatttttttgctttcgtttcttttggttattggatagtaaaattaaaggatgtttgcagga |
46594877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 91 - 133
Target Start/End: Complemental strand, 46594887 - 46594845
Alignment:
| Q |
91 |
tgtttgcaagagctgtctgaatcaggaagcaatttattcaaag |
133 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46594887 |
tgtttgcaggagctgtctgaatcaggaagcaatttattcaaag |
46594845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University