View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6216_low_7 (Length: 420)
Name: NF6216_low_7
Description: NF6216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6216_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 29 - 267
Target Start/End: Complemental strand, 2404285 - 2404047
Alignment:
| Q |
29 |
accatcttctaatttcttattgttctaacctcccatgttctacaccataaaaattctttcccatgttctaagttccataaccaagatgatcaatgacaac |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2404285 |
accatcttctaatttcttattgttctaacctcccatgttctacaccataaaaattcttttccatgttctaagttccataaccaagatgatcaatgacaac |
2404186 |
T |
 |
| Q |
129 |
accccattctttgaactctatctcttaaaattccattgtacaaagcaactctatttgctggcattgcttttgtttctggaatttcatttctgcattcatt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2404185 |
accccattctttgaactctatctcttaaaattccattgtacaaagcaactctatttgctggcattgcttttgtttctggaatttcatttctgcattcatt |
2404086 |
T |
 |
| Q |
229 |
aattgatactctgtttttcttccccggtttttctctaaa |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2404085 |
aattgatactctgtttttcttccccggtttttctctaaa |
2404047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 361 - 407
Target Start/End: Complemental strand, 2403954 - 2403908
Alignment:
| Q |
361 |
taataaatatagtgaatgtttcatacaaaatatccaggacaaaacat |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2403954 |
taataaatatagtgaatgtttcatacaaaatatccaggacaaaacat |
2403908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University